bold coordinates question


#1

Hi all,

Is there a way to get longitude and latitude information related to each BOLD accesion? the function bold_seq gives back four entries; id, name, gene, and sequence but not lon and lat.

Thanks in advance!


#2

Thanks for your question about the bold package @nereal

Checkout the function bold_seqspec(), which gets sequence data and specimen data, e.g.,

res <- bold_seqspec(taxon = "Coelioxys")
tibble::as_tibble(res[, c("lat", "lon", "nucleotides")])
#> # A tibble: 315 x 3
#>      lat      lon nucleotides
#>    <dbl>    <dbl> <chr>
#>  1  47.4   16.3   ---------------------------------------------------------------------------------------------------------------------------------------------AATAATGATATAATTTATAAC…
#>  2  52.9 -118.    TATAATATATATAATTTTTGCAATATGATCAGGAATAATTGGATCTTCTATAAGTATAATTATTCGAATAGAATTAAGAATCCCAGGATCATGAATTAATAATGATCAAATTTATAACTCTTTTATTACAGCACATGCATTTTTAATAATTTTTTTTTTAGT…
#>  3  NA     NA     -------------------------------GGTATAATTGGATCATCTTTAAGAATAATTATTCGCATAGAATTAAGAATCCCGGGTTCTTGAATTAACAATGATCAAATTTATAATTCTTTTATTACAGCTCATGCCTTTTTAATAATTTTTTTCCTAGT…
#>  4  NA     NA     CATCCTATATATAATTTTTGCCATATGGTCAGGAATAATTGGATCTTCATTAAGAATAATTATTCGTATAGAATTAAGAATCCCAGGCTCTTGGATTAGTAATGACCAAATTTATAATTCTTTTATTACTGCTCATGCATTTTTAATAATTTTTTTTTTAGT…
#>  5  51.5   -0.967 ATAAAGATATTGGTATAATATATATAATTTTTGCTATATGATCAGGAATAATTGGATCTTCATTAAGAATAATTATTCGAATAGAATTAAGAATTCCAGGGTCTTGAATTAATAATGACCAAATTTATAATTCTTTCATTACAGCCCATGCATTTTTAATAA…
#>  6  NA     NA     ----------------------------------ATAATTGGATCTTCTTTAAGAATAATCATTCGAATAGAATTAAGAACTCCAGGATCTTGAATTAATAATGATCAAATCTATAACTCATTTATTACCGCCCATGCATTTCTAATAATTTTTTTTTTAGT…
#>  7  NA     NA     AATATTATATATAATTTTTGCTATATGATCTGGAATAATTGGATCTTCATTAAGAATAATTATTCGAATAGAATTAAGAATTCCAGGGTCATGAATTAATAATGATCAAATTTATAATTCTTTCATTACAGCTCATGCATTTTTAATAATTTTTTTTTTAGT…
#>  8  18.8  -96.9   -ATATTATATATAATTTTTGCTATATGATCTGGAATAATTGGATCTTCATTAAGAATAATTATTCGAATAGAATTAAGAATTCCAGGATCATGAATCAATAATGATCAAATTTATAATTCTTTTATTACAGCTCATGCATTTTTAATAATTTTTTTTTTAGT…
#>  9  NA     NA     ---------------------------------AATAATTGGATCATCAATTAGAATATTAATTCGAATAGAATTAAGAATTCCTGGAACATGAATTAATAATGATCAAATCTATAATTCATTTATTACCGCTCATGCATTTTTAATAATTTTTTTTTTAGT…
#> 10  52.2   13.5   AATAATATATATAATTTTTGCTATATGATCAGGAATAATTGGTTCTTCATTAAGAATAATTATTCGTATAGAATTAAGAATTCCTGGAGCTTGAATTAATAATGATCAAATTTATAATTCATTTATTACAGCTCACGCATTTATAATAATTTTTTTTTTAGT…
#> # … with 305 more rows

Does that get what you want?


#3

Yes, fantastic! sorry i missed that funtion out

Thank you Sckott